There is a new ace file format (since early 1998). If you still haven't changed to the new ace file format, you must do so now since it contains information that is not contained in the old ace file format. This additional information (e.g., the alignment and quality clipping values) are essential for some of the Consed functions (e.g., navigate by single stranded, navigate by single subclone, Autofinish) to work correctly. Another reason to switch to the new ace format is that you will get faster Consed startup performance. The new ace file format is also much smaller (about 60% as big as the old). The new phrap (Aug 1998 and better) writes the new ace format (using the -new_ace switch). Since Consed now uses the additional information found only in the new ace format, if you are editing an assembly, you should first re-phrap to take advantage of this additional information. Consed can read either old or new ace format. Consed can also write either new or old ace format. It write the new ace format by default--see 'Options'/'General Preferences'. Also see the Consed parameter: consed.writeThisAceFormat: 2 (where 2 means 'new' and 1 means 'old') If you have scripts that read the ace file, you will need to modify those scripts for the new ace format. Here is the format:
Refer to the accompanying sample_ace_file.txt (below)
AS <number of contigs> <total number of reads in ace file>
CO <contig name> <# of bases> <# of reads in contig> <# of base segments in contig> <U or C>
The U or C indicates whether the contig has been complemented from the
way phrap originally created it. Thus this is always U for an ace
file created by phrap.
BQ
This starts the list of base qualities for the unpadded consensus
bases. The contig is the one from the previous CO, hence no name is
needed here.
AF <read name> <C or U> <padded start consensus position>
This line replaces the 'AssembledFrom*' line in the previous ace file
format. C or U means complemented or uncomplemented. The <read name>
is the true read name (no .comp on it as with the previous ace file
format.)
BS <padded start consensus position> <padded end consensus position> <read name>
This replaces the 'BaseSegment*' line from the previous ace file format.
RD <read name> <# of padded bases> <# of whole read info items> <# of read tags>
QA <qual clipping start> <qual clipping end> <align clipping start> <align clipping end>
This is new information not found in the previous ace file. If the
entire read is low quality, then <qual clipping start> and <qual
clipping end> will both be -1. These positions are offsets from the
left end of the read (left, as shown in Consed). Hence for bottom
strand reads, the offsets are from the end of the read. The offsets
are 1-based. That is, if the left-most base is in the aligned,
high-quality region, <qual clipping start> = 1 and <align clipping
start> = 1 (not zero).
DS CHROMAT_FILE: <name of chromat file> PHD_FILE: <name of phd file> TIME: <date/time of the phd file> CHEM: <prim, term, unknown, etc> DYE: <usually ET, big, etc> TEMPLATE: <template name> DIRECTION: <fwd or rev>
There can be additional information on this line.
This replaces the DESCRIPTION line from the old ace file.
The following is for transient read tags (those generated by
crossmatch and phrap). They are not fully implemented, and the format
may eventually change. The read is implied by the location of the
whole read info item within the ace file. They are found after the DS
line for a read.
RT{
<read name> <tag type> <what program created tag> <padded read pos start> <padded read pos end> <date when tag was created in form YYMMDD:HHMISS>
}
for example:
RT{
djs14_680.s1 matchElsewhereLowQual phrap 904 933 990823:114356
}
There are consensus tags now in the ace file. All consensus tags have
the following format:
CT{
<contig name> <tag type> <what program created tag> <padded cons pos start> <padded cons pos end> <date when tag was created in form YYMMDD> <NoTrans>
(possibly additional information)
}
The NoTrans is optional--it indicates that, when you reassemble, this
tag should not be transferred to the new assembly. This is true with
tags that should be recreated each time because they have to do with
the assembly (e.g., repeat tags).
e.g.,
CT{
Contig206 repeat tagRepeats.perl 118732 119060 990823:115033 NoTrans
AluY
}
In the case of most consensus tag types, there is only 1 line for the
consensus tag. In the case of comment tags and oligo tags, there are
additional lines of information. The comment tag includes the comment
on the additional lines. The oligo tag has the following information:
<oligo name> <oligo bases from 5' to 3'> <melting temp> <C or U
indicating whether the oligo is top strand or bottom strand relative
to the orientation of the contig as created by phrap>
WA{
<tag type> <what program created tag> <date tag was created in form YYMMDD:HHMISS>
1 or more lines of data
}
This line is a 'whole assembly' tag. It is used for information
referring to the assembly as a whole. Currently, phrap puts its
version and phrap command line options in a WA tag.
You can append CT, WA, and RT tags to the end of the ace file in any
order you like.
AS 1 8
CO Contig1 1475 8 156 U
agccccgggccgtggggttccttgagcactcccaaagttccaacccagga
tgtccccgacgcttaaaccttccaagtctgaaacgggaaatttgatttgc
gggctaggataaacgccggggagaaaggcagaactgccttttacccccca
aggatatcccttgggaagggcccctttgcactcagctgctccctaattat
ggcgatcctccctctatctttgtccccctgtctttcaggatccctctcAA
CAACAgaccaCTCccattaaaGAAATCtccttctgatctgcgggatcACA
TAAAACAGTGCCattcAAaAcgtcccttcCcccAATGTCtaagtgTggtg
gagcCcttcctgcCCggctctgtgcacccacggtgcctgcatgaccccgg
atGCAGTGTGCACCAGctCCCATCATTCAAgagCATGACTGTGTTGCCAA
CCAGCcacCAGGCACTGGGGAGGGAGCtgaGGGAGCAcaaAAGGGATGAG
CCACCCTCTGTcCcagAAGTGGAGGGCATGGGGCTTGGCTGGGCTTAGAG
CTAACATACACAGGATGCTGAAAAAGAACAACACAAggtGTGTGGAGCAA
AGGAAAGGGAAATCAGCTTGAAGCTGATGTTAGTGTGCTTGGGCTGAGTA
CAGCCATGCTCTCAGTTGAGGCACGGTTGGCTCCCCATGGGCAAGATCCC
TCCTGGCCCATCTCTCCTCTTATTCTCTATCCCTTCCCCAGGTCCCTGCC
TTAGAGGTTTCACCAGAGCACAGCTCCTGCCTGTGGCCAAAACAGTATTT
GGCCACTCACCGACCCAGTGTCAGC*ATCCAGATGGGTTCCACATCTCAC
AACCCT*GAGCAGCAGAGAAGGGTTTGAAAGGCCAGGGGAG*AATGAAGA
CGAAGGAGG*TGTTGGCAACAACACAGA*G*AGTCAGCAGCCAGAACGCC
AGGTATCCACACACATAAGACATTCTAAATTTTTACTCAACAGAAATTGT
CTATGTCTGTGTCTGGGCACCATGGCAACACCTTATCTCTACAAAAATTA
GCGGAATGTAGTGGTGCCTGTGTGTAGTCCCAGCTATTCAAGAGGCTGAA
GTGGGAGGATTGCTTGAGCCATGGAAGTCAAGGCTGTAGTGAGCCATGAT
TGTGTCAATGCACTCCAGACAGAGCAAGACCCTGCTCCCACCACACACCT
CaaacgaaAAAAAAaaagggcaaagatatgaactgaaatggaatatag*a
gcagcaaaaggaacagaaaattgtctatgcctggttctctagtcatgtgc
agaacagacagtatcccggccctattgagttcttggggcagttaggcttg
tgcacccttgcttctatgccacagttagggcattcgggattcccatcctt
ttccccggggttgctttttgtttgcgattaccttttcggaacaatggggg
gaaattattttccaagttgggtttg
BQ
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 23 22
23 26 24 25 25 17 17 13 14 19 21 22 22 17 17 11 8 7 10 13 18 23 28 28 31 31 32 18 18 10 10 10 12 15 8 6 6 8 8 10 15 9 11 12 15 14 15 20 20 28
30 31 24 24 22 24 25 28 23 27 24 27 18 15 15 16 21 23 18 20 13 8 7 7 12 10 9 10 10 21 12 14 14 28 27 32 24 23 20 19 15 17 15 17 19 20 13 13 13 14
14 10 10 10 23 10 10 10 10 10 11 11 18 25 24 10 10 10 10 10 14 10 11 11 11 13 12 12 10 12 10 10 10 10 10 10 14 10 12 10 10 10 10 10 10 10 14 13 15 15
17 19 24 32 37 37 37 37 32 30 30 30 28 23 23 25 15 15 20 27 32 23 22 22 27 32 34 34 21 21 12 12 12 24 32 41 45 45 37 45 45 45 45 45 37 37 37 41 41 37
37 37 41 32 32 14 14 19 32 28 37 37 41 41 45 45 37 37 37 30 30 32 32 37 37 32 28 16 16 17 32 32 37 45 37 25 25 9 9 9 25 25 37 37 37 37 37 45 40 37
37 37 45 45 37 37 37 37 38 25 25 12 25 10 10 15 32 47 52 62 62 55 43 43 34 43 43 58 58 78 77 72 72 70 70 70 74 77 69 68 55 55 55 57 61 65 70 73 68 61
64 58 56 56 64 65 67 70 70 75 79 70 70 70 70 70 70 67 71 71 71 84 63 63 62 62 62 59 59 61 61 64 64 49 42 32 10 6 18 32 35 46 47 48 47 47 47 55 55 55
55 49 46 47 47 55 55 55 54 47 47 47 48 48 54 54 54 48 48 55 47 47 47 55 49 48 48 48 55 47 48 48 47 47 47 46 48 48 48 50 44 43 44 44 49 49 73 75 82 78
74 66 66 58 54 60 68 68 61 63 47 57 45 74 85 78 70 65 62 61 61 55 73 65 59 61 75 77 80 86 81 81 83 85 85 85 90 84 78 78 73 75 78 77 86 75 76 83 79 84
87 78 72 75 72 72 76 79 82 88 90 89 89 89 89 89 90 90 90 85 85 79 83 83 90 90 90 90 90 90 90 90 90 90 90 90 90 89 89 89 90 90 90 90 90 90 90 90 90 90
90 90 90 81 66 66 62 62 62 73 89 90 90 86 86 86 86 88 88 90 90 90 90 90 90 90 88 71 68 61 61 66 66 70 65 64 70 70 76 90 90 90 90 90 90 85 90 90 90 87
87 79 79 79 79 89 74 65 71 72 79 73 73 70 75 79 76 81 81 83 80 87 89 90 82 82 90 88 88 88 88 89 86 77 77 80 79 79 79 90 90 90 90 79 79 61 58 53 76 63
57 65 76 76 76 80 89 89 89 90 90 90 90 88 88 88 88 88 88 90 90 90 90 90 90 90 90 90 90 88 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 83 79 58 43
45 68 70 61 75 76 73 68 84 88 90 90 90 90 90 89 72 54 62 62 53 55 55 80 83 80 80 83 85 83 87 83 83 83 85 85 86 86 84 81 83 82 77 78 76 76 77 77 80 88
88 87 90 90 90 90 85 84 82 71 75 62 62 37 68 75 77 74 70 71 70 72 72 80 80 80 84 83 82 66 70 55 55 55 37 55 55 55 55 55 55 55 55 54 55 55 55 48 47 47
47 47 47 47 47 47 47 47 55 50 50 50 47 47 47 47 44 44 55 48 51 51 54 54 54 54 54 55 54 54 55 55 55 55 55 55 55 55 55 55 55 55 55 51 51 51 54 51 61 61
61 61 61 61 44 42 34 34 37 37 37 44 47 47 47 61 61 61 61 61 61 61 47 49 48 47 55 54 55 55 55 55 55 44 44 44 44 46 43 43 44 44 44 51 44 47 44 34 44 44
44 44 39 39 43 42 50 42 42 38 37 38 41 50 52 55 47 47 39 44 44 46 41 42 40 43 40 41 42 38 37 42 55 50 44 44 46 48 55 55 55 37 34 34 33 42 47 42 42 42
42 55 46 46 46 48 47 48 46 43 41 39 42 39 44 44 44 48 48 38 36 36 38 38 38 44 44 44 44 44 44 42 42 36 41 40 36 36 30 33 32 29 28 28 23 12 16 10 8 8
13 14 23 20 21 28 28 31 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AF K26-217c U 498
AF K26-526t U 510
AF K26-961c U 577
AF K26-394c U 797
AF K26-291s U 828
AF K26-822c U 883
AF K26-572c C 1
AF K26-766c C 408
BS 1 515 K26-572c
BS 516 516 K26-217c
BS 517 521 K26-572c
BS 522 529 K26-217c
BS 530 538 K26-572c
BS 539 569 K26-217c
BS 570 571 K26-526t
BS 572 573 K26-217c
BS 574 579 K26-526t
BS 580 584 K26-217c
BS 585 591 K26-526t
BS 592 592 K26-217c
BS 593 601 K26-526t
BS 602 604 K26-217c
BS 605 606 K26-526t
BS 607 607 K26-217c
BS 608 621 K26-526t
BS 622 628 K26-217c
BS 629 629 K26-526t
BS 630 630 K26-217c
BS 631 633 K26-526t
BS 634 634 K26-217c
BS 635 635 K26-526t
BS 636 639 K26-217c
BS 640 646 K26-526t
BS 647 648 K26-217c
BS 649 649 K26-526t
BS 650 650 K26-217c
BS 651 654 K26-766c
BS 655 655 K26-961c
BS 656 656 K26-217c
BS 657 669 K26-961c
BS 670 675 K26-217c
BS 676 676 K26-961c
BS 677 688 K26-217c
BS 689 693 K26-526t
BS 694 696 K26-217c
BS 697 698 K26-526t
BS 699 700 K26-961c
BS 701 706 K26-217c
BS 707 707 K26-961c
BS 708 708 K26-217c
BS 709 709 K26-961c
BS 710 710 K26-526t
BS 711 775 K26-961c
BS 776 776 K26-766c
BS 777 777 K26-961c
BS 778 834 K26-766c
BS 835 837 K26-961c
BS 838 840 K26-394c
BS 841 882 K26-766c
BS 883 884 K26-394c
BS 885 898 K26-766c
BS 899 899 K26-961c
BS 900 900 K26-766c
BS 901 901 K26-961c
BS 902 934 K26-766c
BS 935 935 K26-394c
BS 936 936 K26-766c
BS 937 937 K26-394c
BS 938 940 K26-766c
BS 941 944 K26-394c
BS 945 945 K26-291s
BS 946 948 K26-822c
BS 949 949 K26-766c
BS 950 951 K26-822c
BS 952 954 K26-766c
BS 955 955 K26-822c
BS 956 957 K26-394c
BS 958 962 K26-822c
BS 963 963 K26-394c
BS 964 970 K26-822c
BS 971 971 K26-394c
BS 972 972 K26-822c
BS 973 973 K26-394c
BS 974 976 K26-822c
BS 977 979 K26-394c
BS 980 986 K26-291s
BS 987 987 K26-394c
BS 988 1004 K26-822c
BS 1005 1009 K26-394c
BS 1010 1012 K26-291s
BS 1013 1014 K26-394c
BS 1015 1021 K26-822c
BS 1022 1022 K26-394c
BS 1023 1026 K26-822c
BS 1027 1028 K26-291s
BS 1029 1036 K26-822c
BS 1037 1052 K26-291s
BS 1053 1053 K26-822c
BS 1054 1060 K26-291s
BS 1061 1061 K26-822c
BS 1062 1062 K26-291s
BS 1063 1065 K26-394c
BS 1066 1068 K26-822c
BS 1069 1079 K26-291s
BS 1080 1081 K26-822c
BS 1082 1082 K26-291s
BS 1083 1084 K26-822c
BS 1085 1089 K26-291s
BS 1090 1094 K26-822c
BS 1095 1096 K26-394c
BS 1097 1099 K26-822c
BS 1100 1100 K26-291s
BS 1101 1104 K26-822c
BS 1105 1105 K26-394c
BS 1106 1110 K26-822c
BS 1111 1115 K26-291s
BS 1116 1122 K26-822c
BS 1123 1124 K26-291s
BS 1125 1135 K26-822c
BS 1136 1136 K26-394c
BS 1137 1139 K26-822c
BS 1140 1140 K26-291s
BS 1141 1150 K26-822c
BS 1151 1155 K26-291s
BS 1156 1161 K26-822c
BS 1162 1164 K26-291s
BS 1165 1167 K26-822c
BS 1168 1173 K26-291s
BS 1174 1175 K26-822c
BS 1176 1189 K26-291s
BS 1190 1196 K26-822c
BS 1197 1199 K26-291s
BS 1200 1221 K26-822c
BS 1222 1225 K26-291s
BS 1226 1227 K26-822c
BS 1228 1228 K26-394c
BS 1229 1231 K26-291s
BS 1232 1233 K26-822c
BS 1234 1235 K26-291s
BS 1236 1236 K26-394c
BS 1237 1239 K26-291s
BS 1240 1242 K26-822c
BS 1243 1244 K26-291s
BS 1245 1247 K26-394c
BS 1248 1255 K26-822c
BS 1256 1256 K26-291s
BS 1257 1257 K26-394c
BS 1258 1258 K26-291s
BS 1259 1259 K26-822c
BS 1260 1260 K26-394c
BS 1261 1265 K26-291s
BS 1266 1266 K26-822c
BS 1267 1268 K26-394c
BS 1269 1269 K26-822c
BS 1270 1275 K26-291s
BS 1276 1280 K26-822c
BS 1281 1281 K26-394c
BS 1282 1290 K26-822c
BS 1291 1292 K26-291s
BS 1293 1294 K26-822c
BS 1295 1297 K26-291s
BS 1298 1301 K26-822c
BS 1302 1302 K26-291s
BS 1303 1475 K26-822c
RD K26-217c 563 0 0
tcccCgtgagatcatcctgaAGTGGAGGGCATGGGGCTTGGCTGGGCTTA
GAGCTAACATACACAGGATGCTGAAAAAGAACAACACAAgntGTGTGGAG
CAAAGGAAAGGGAAATCAGCTTGAAGCTGATGTTAGTGTGCTTGGGCTGA
GTACAGCCATGctntCAGTTGAGGCACGGTTGGCTCCCCATGGGCAAGAT
CCCTCCTGGCCCATCTCTCCTCTTATTCTCTATCCCTTCCCCAGGTCCCT
GCCTTAGAGGTTTCACCAGAGCACAGCTCCTGcctgtggccaAAACAGTA
TTTGGCCACTCACcGAcccagTGTCAGC*atccaGatggGtTccacatct
cacaaccct*gggcagcagagaaggggtttaaaggccagggggg*tatta
agccgaaggagg*ttttggaaacaccaaggg*g*ggtcagaccccaacgc
cagtttccccaaaaaggggcattcaaatttttttctcagagattttcttt
ccttttttgggccccgggaaccttttttaaaaaatgggggattgggcccc
cttggcccccctc
QA 19 349 19 424
DS CHROMAT_FILE: K26-217c PHD_FILE: K26-217c.phd.1 TIME: Thu Sep 12 15:42:38 1996
RD K26-526t 687 0 0
ccgtcctgagtggAGggcatggggcttggctggGCTTAGAGCTAACATAC
ACAGGATGCTGAAAAAGAACAACACAAggtGTGTGGAGCAAAGGAAAGGG
AAATCAGCTTGAAGCTGATGTTAGTGTGCTTGGGCTGAGTACagcnatgc
tntgaGTTGAggaacgGTTGGCTCCCCATGGGCAAGATCCCTCCTGGCCC
ATCTCTCCTCTTATTCTCTATCCCTTCCCCAGGTCCCTGCCTTAGAGGTT
TCACcAgAGCACAgCTCctgcctgtggccaAAACAGTATTTGGccACTCA
CCGAcCCAGTGTcagt*atccAGATGGGttccACATCtcacagcccT*Ga
gcAgcagngaaGGGTttgaaagggcAgggggggaatgaaGacggaggagg
gtgttggcaaccacacaga*ggagtcaggaggcaggacggcaggtatccA
Cacacattaggcattttaaatttttacttaacaggaattgtctatggctg
ggtttgggaac*atgggaacacctattcttt*caaaa*ttggggggat*t
agtggtgc*tgt*tatagtcccgttattaaGggttaagtggggtttcttt
gccaggaggtaaggtttggggccctatttttaattacttggaaggaagcc
ttttcccagataaggaaaaaggaggtTTtttgtttta
QA 12 353 9 572
DS CHROMAT_FILE: K26-526t PHD_FILE: K26-526t.phd.1 TIME: Thu Sep 12 15:42:33 1996
RD K26-961c 517 0 0
aatattaccggcgcggggttCcgTCGGAAAGGGAAATCAGCTTGAAGCTG
ATGTTAGTGTGCTTGgGCTGAGTacaGCCATGCTCTCAGTTGAGGCACGG
TTGGCTCCCCATGGGCAAGATCCCTCCTGGCCCATCTCTCCTCTTATTCT
CTATCCCTTCCCCAGGTCCCTGCCTTAGAGGTTTCACCAGAGCACAGCTC
CTGccTGTGGCCAAAACAGTATTTGGccactgaccGACCCagtGTCAGC*
ATCCAGATGGGTTCCACATCTCacaaccCT*GAGCAGCAGAGAAGGGTTT
GAaagGcCAGGGGAG*AATGAAGACgaaggaGG*TGTTgGcaacaacaca
gA*G*AGTCAGCAGccAgaacgccaggtatccacACACATaaggCATtct
aaatttttaCtcaACaggaattgtctATgtctgtgTCtgggcaccagggc
a*cacctTATCTCTAcaaaaat*agcgggatttagtggtgcttgtgtg**
g*cccagctattcaggg
QA 20 415 26 514
DS CHROMAT_FILE: K26-961c PHD_FILE: K26-961c.phd.1 TIME: Thu Sep 12 15:42:37 1996
RD K26-394c 628 0 0
ctgcgtatcgtcacc*accCAGTGTCagctatcCAGATGGGTTCCACATC
TcacaacCCT*GAGCAGCAGAGAAGGGTTTGAAAGGCCAGGGGAG*AATG
AAGACga*gGAGG*tgTTGGCAACAacacagA*G*AGTCAGCAGCCAGAA
CGCCAGGTATCCACACACATAAGACATTCTAAATTTTTACTCAACAGAAA
TTGTCTATGTCTGTGTCTGGgcaCCATGGCAACACCTTATCTCTACAAAA
ATTAGCGGAATGTAGTGGTGCCTGtgtGTAGTCCCAGCTATTCaaGAGGC
TGAAGTGGGAGGATTGCTTGagccaTggaagtcaagGCTGTAGTGagCCa
TGattgtgtCaATGCACtcnagAcagagcaaGACCctgctcccaccacac
aacttaanaggaaaaaaaaaaaggaaaagaaatgaaatgaaatgggatat
ag*aa*aggaaaagga*cagaaa*ttgtctatgcctggt*ctctagtaat
gtcagtcagccagtttccagccttttggtcttgggcattctgctgtcaca
atctcttggaacgttgggcagggaatcccatttttcccccgtttTttttt
gtggcaattaccttttggaaccctgggt
QA 18 368 11 502
DS CHROMAT_FILE: K26-394c PHD_FILE: K26-394c.phd.1 TIME: Thu Sep 12 15:42:32 1996
RD K26-291s 556 0 0
gaggatcgcttTCCacatctcaCAaccctcgagCAgCagagAAgggTTTG
AAAGGCCAGGGGAG*AATGAAGACGa*ggAGG*TGTTGGCAACAacacag
a*G*AGTCAGCAGCCAGAACGCCAggtaTCCAcacacataAgccatTCTA
AATTTTTACTCAAcagAAATTGTCTAtgTCTGTGTCTGggcacCATGGCA
ACACCTTATCTCTACAAAAATTAGCGGAATGTAGTggtGCCTGTGTGTAG
TCCCAGCTATTCAAgaggctGAAGTgcgaggatTGCTTgagCCATGGAAG
TcaaggctgtAGTGAgccatgatTGTGTCAATGCACTCCAGACAGAGCAA
GACCCTGCTCCCAccaCACAcctcaaaaggtattgattaaaGGAaAagaa
atgaaAtgaaatgagataaaggaaaaggaaaaagaacaggatattgTCtA
Tgcctgat*ctctagt*atgtgcagacagaagtttccagccactgagttc
ttgccccagctaactttttacaaatccccctggggaaggtttggcccagg
cagatg
QA 11 373 11 476
DS CHROMAT_FILE: K26-291s PHD_FILE: K26-291s.phd.1 TIME: Thu Sep 12 15:42:31 1996
RD K26-822c 593 0 0
ggggatccg*tcatgagacga*ggAGG*TGTTGGCAACa*ca*agaag*A
GTCAGCAGCCAGAACGCCAGGTATCCACACACATAAGACATTCTAAATTT
TTACTCAACAGAAATTGTCTATGTCTGtgtCTGGGCACCATGGCAACACC
TTATCTCTACAAAAATTAGCGGAATGTAGTggTGCCTGtgtGTAGTCCCA
GCTATTCAAGAGGCTGAAGTGGGAGGATTGCTTGAGCCATGGAAGTCAAG
GCTGTAGTGAGCCATGATTGtgtCAATGCACTCCAGAcAgAGCaAgacCC
tgCTCccACCACACacctCaaacgaaAAAAAAaaagggcaaagatatgaa
ctgaaatggaatatag*agcagcaaaaggaacagaaaattgtcTATGcct
ggttctctagtcatgtgcagaacagacagtatcccggccctattgagttc
ttggggcagttaggcttgtgcacccttgcttctatgccacagttagggca
ttcgggattcccatccttttccccggggttgctttttgtttgcgattacc
ttttcggaacaatggggggaaattattttccaagttgggtttg
QA 25 333 16 593
DS CHROMAT_FILE: K26-822c PHD_FILE: K26-822c.phd.1 TIME: Thu Sep 12 15:42:36 1996
RD K26-572c 594 0 0
agccccgggccgtggggttccttgagcactcccaaagttccaacccagga
tgtccccgacgcttaaaCcttccaagtctgaaacgggaaAtttgatttgc
gggctaggataaacgccggggagaaaggcagaactgccttttaccCCcca
aggatatcccttgggaagggcccctttgcactcagctgctccctaattat
ggcgatcctccctctatctttgtccccctgtctttcaggatccctctcAA
CAACAgaccaCTCccattaaaGAAATCtccttctgatctgcgggatcACA
TAAAACAGTGCCattcAAaAcgtcccttcCcccAATGTCtaagtgTggtg
gagcCcttcctgcCCggctctgtgcacccacggtgcctgcatgaccccgg
atGCAGTGTGCACCAGctCCCATCATTCAAgagCATGACTGTGTTGCCAA
CCAGCcacCAGGCACTGGGGAGGGAGCtgaGGGAGCAcaaAAGGGATGAG
CCACCCTCTGTcCcagAAGTGGAgcgcATGGGGCTTGGCTgggcTTAGAG
CtaacaTACACAGGATGCTGAAaaagaaCAACACaatagtaaca
QA 249 584 1 586
DS CHROMAT_FILE: K26-572c PHD_FILE: K26-572c.phd.1 TIME: Thu Sep 12 15:42:34 1996
RD K26-766c 603 0 0
gaataattggaatcacggcaaaaatttggggacaaatattatttccaaaa
ttcccccagcaatcacacaggccctcaagcccatcaactcggtcattcac
cgattttcctaaatcaagggtattagcttg*ctgggcttacacctaacat
acacagcatgctcaatgagaAcaatacgagctgtgtggagcacaggaagg
ggaAAtcagcctgaagctgctgttagtgtgcttgg*ctgAGTACAGCcaT
GCTctCAGTTgaggcAcggTTGGCTCCCCATGGgCAAGATCCCTCCTggC
CCATCTCTCCTCTTaTTCTCTATCCCTTCCCCAGGTCCCTGCCTTAGagg
tttCACCAGAGCACAGCTCCTGCCTGTGGCCAAAACAGTATTTGGCCACT
CACCGACCCAGTGTCAGC*ATCCAGATGGGTTCCACATCTCACAACCCT*
GAGCAGCAGAGAAGGGTTTGAAAGGCCAGGGGAG*AATGAAGACGAAGGA
GG*TGTTGGCAACAACACAGA*G*AGTCAGCAGCCAGAACGCCAGGTATC
CACACACATAagaCATtctaAATTTTTACTCAAacgatcCccggaaccac
acg
QA 240 584 126 583
DS CHROMAT_FILE: K26-766c PHD_FILE: K26-766c.phd.1 TIME: Thu Sep 12 15:42:35 1996
WA{
phrap_params phrap 990621:161947
/usr/local/genome/bin/phrap standard.fasta.screen -new_ace -view
phrap version 0.990319
}
CT{
Contig1 repeat consed 976 986 971218:180623
}
CT{
Contig1 comment consed 996 1007 971218:180623
This is line 1 of a comment
There may be any number of lines
}
CT{
Contig1 oligo consed 963 987 971218:180623
standard.1 acataagacattctaaatttttact 50 U
seq from clone
}