**************************************************** * NAGRP Livestock Genome Database and Web Site * * http://www.animalgenome.org * * * * U S A G E S T A T I S T I C S * * * **************************************************** Begin: 01/Feb/2011:00:00:13 End : 28/Feb/2011:23:59:52 Summary ________________________________________________________ 429006 hits were received from 24541 unique internet sites that made requests on 64436 files, resulting in 39109 Megabytes of network traffic. Major catagory break-downs ______________________________ 24.177 Mb - ANGENMAP Activities ( 24176506 bytes) 16424.565 Mb - Aquaculture Information (16424565287 bytes) 248.111 Mb - Bioinfo Information ( 248111094 bytes) 1726.079 Mb - Blast server (1726079402 bytes) 6165.999 Mb - Cattle Information (6165998646 bytes) 27.479 Mb - Chicken Information ( 27478541 bytes) 188.365 Mb - Community Activities ( 188364770 bytes) 61.357 Mb - Databases and Maps Info ( 61357064 bytes) 631.381 Mb - Education Materials ( 631381031 bytes) 0.454 Mb - Expeditor Tool ( 453771 bytes) 0.065 Mb - FTP Downloads ( 64645 bytes) 506.387 Mb - GBrowse ( 506386916 bytes) 526.646 Mb - Graphics ( 526645724 bytes) 40.602 Mb - Newsletters ( 40601717 bytes) 1.444 Mb - Other Users ( 1444428 bytes) 57.171 Mb - Pig Information ( 57170807 bytes) 929.681 Mb - QTL Database ( 929681314 bytes) 843.067 Mb - Resources Sharing ( 843066781 bytes) 12.780 Mb - Site Statistics ( 12780413 bytes) 37.701 Mb - Utility Tools ( 37700608 bytes) _________________________________________________________ I. Web access statistics in time dimension (1) Daily activities, in number of files transmitted (* = 766) 15592 files on Feb 01 : ********************* 15590 files on Feb 02 : ********************* 12219 files on Feb 03 : **************** 12959 files on Feb 04 : ***************** 7103 files on Feb 05 : ********** 10994 files on Feb 06 : *************** 18178 files on Feb 07 : ************************ 21559 files on Feb 08 : ***************************** 18553 files on Feb 09 : ************************* 21210 files on Feb 10 : **************************** 12821 files on Feb 11 : ***************** 7685 files on Feb 12 : *********** 8715 files on Feb 13 : ************ 15177 files on Feb 14 : ******************** 19787 files on Feb 15 : ************************** 22643 files on Feb 16 : ****************************** 18251 files on Feb 17 : ************************ 17307 files on Feb 18 : *********************** 7168 files on Feb 19 : ********** 9426 files on Feb 20 : ************* 14973 files on Feb 21 : ******************** 17464 files on Feb 22 : *********************** 20212 files on Feb 23 : *************************** 19159 files on Feb 24 : ************************** 15623 files on Feb 25 : ********************* 8794 files on Feb 26 : ************ 12994 files on Feb 27 : ***************** 26850 files on Feb 28 : ************************************ (2) 24-hour cycle, in terms of network loads (kilobytes) (* = 135796) 6287278 kb downloaded during 00:00-00:59 : ****************************************+ 2654291 kb downloaded during 01:00-01:59 : ******************** 2442182 kb downloaded during 02:00-02:59 : ****************** 2438257 kb downloaded during 03:00-03:59 : ****************** 2387338 kb downloaded during 04:00-04:59 : ****************** 2469114 kb downloaded during 05:00-05:59 : ******************* 2773727 kb downloaded during 06:00-06:59 : ********************* 1968199 kb downloaded during 07:00-07:59 : *************** 438857 kb downloaded during 08:00-08:59 : **** 635152 kb downloaded during 09:00-09:59 : ***** 534626 kb downloaded during 10:00-10:59 : **** 415017 kb downloaded during 11:00-11:59 : **** 436571 kb downloaded during 12:00-12:59 : **** 4563877 kb downloaded during 13:00-13:59 : ********************************** 4054807 kb downloaded during 14:00-14:59 : ****************************** 347756 kb downloaded during 15:00-15:59 : *** 313638 kb downloaded during 16:00-16:59 : *** 274174 kb downloaded during 17:00-17:59 : *** 2506530 kb downloaded during 18:00-18:59 : ******************* 267796 kb downloaded during 19:00-19:59 : ** 206561 kb downloaded during 20:00-20:59 : ** 290531 kb downloaded during 21:00-21:59 : *** 209403 kb downloaded during 22:00-22:59 : ** 193753 kb downloaded during 23:00-23:59 : ** II. User Statistics (1) Top 20 sites, in number of files transmitted. 13694 208.68.143.203 10535 178.162.174.205 10355 195.37.182.216 7725 203.255.22.77 4428 escalese.student.iastate.edu 4026 h-98-165.scoutjet.com 3153 ABTS-AP-dynamic-101.178.169.122.airtelbroadband.in 2826 ec2-174-129-55-2.compute-1.amazonaws.com 2794 hk2-lr680138g.super-goo.com 2766 lancia.itz.uni-bonn.de 2711 221.10.76.178 2621 193.136.157.71 2609 caripark.vpn.iastate.edu 2603 spider80.yandex.ru 2568 182.132.149.194 2539 206-16-59-126.attens.net 2449 165.229.24.106 2423 206-16-59-103.attens.net 2322 n128-227-4-62.xlate.ufl.edu 2322 129.180.70.249 (2) Top 10 domains, in number of files downloaded: 63388 net 49385 com 42567 edu 14785 de 14051 203 10824 205 10443 216 9731 in 7886 77 5728 uk III. Files access statistics (1) Top 30 most accessed directories 48678 /icons/ 36054 /edu/genetics/ 34438 / 26910 /QTLdb/images/ 15200 /icons/buttons/ 14905 /webalizer/ 10010 /icons/general/ 9519 /tmp/ 6577 /blast/ 5565 /gbrowse/js/ 5361 /icons/links/ 4893 /icons/misc/ 4668 /default/ 4446 /edu/QTL/rothschild/lecture2/ 4003 /icons/small/ 3942 /blast/images/ 3237 /edu/PIH/ 3237 /aquaculture/images/ 3119 /QTLdb/references/ 2965 /bioinfo/resources/manuals/Embnetut/Universl/Pictures/ 2928 /share/popupmenu/ 2576 /bioinfo/tools/catego/ 2561 /icons/animals/ 2516 /gbrowse/images/buttons/ 2349 /QTLdb/ 2328 /icons/bullets/ 2212 /bioinfo/resources/manuals/ 1958 /share/popuptxt/ 1789 /edu/QTL/rothschild/lecture3/ 1788 /edu/gene/ (2) Top 30 Most frequently transmitted files 22581 /favicon.ico 18926 /icons/stat_a.jpg 10629 /icons/bk-spiralnotes.gif 8699 / 8179 /edu/genetics/meiosis.gif 6954 /edu/genetics/mitosis.html 6561 /edu/genetics/mit.gif 5716 /webalizer/ 5224 /blast/blast.cgi 4665 /QTLdb/images/titlebar_bg.jpg 4203 /default/style.css 3203 /edu/genetics/sexlim.html 2707 /webalizer/usage_201101.html 2651 /edu/genetics/pedigree.gif 2572 /QTLdb/images/pig_QTLlogosm.jpg 2261 /QTLdb/images/flankmrk.jpg 2244 /QTLdb/images/teststat.jpg 1958 /share/popuptxt/wz_tooltip.js 1820 /webalizer/usage_201102.html 1576 /webalizer/usage_201001.html 1433 /cgi-bin/QTLdb/edit/qtl_upd 1403 /webalizer/usage_201003.html 1389 /share/popupmenu/popupmenu2_7loader.js 1273 /QTLdb/images/pig_QTL_bg2.jpg 1261 /blast/wblast2.cgi?0 1228 /icons/newest.gif 1144 /icons/animals/ranch.jpg 1142 /webalizer/usage_201010.html 1097 /share/popupmenu/popupmenu2_7iens6.js 1057 /QTLdb/images/overview_44.jpg (3) Top 30 Files in terms of network traffic generated (kilobytes) 16067777 /aquaculture/salmonids/rainbowtrout/RTsinglton_wv.fa.gz 7197267 /lunney/genotype.files/Joan_Lunney_Full%2003sep2009_FinalReport_New.txt 2430433 /repository/cattle/BTA4_masked.tgz 1885501 /repository/cattle/UMD3.1_masked.tgz 1017328 /repository/cattle/UMD3_RepeatMasked.tar.gz 807772 /repository/cattle/UMD3_chr.gff.tar.gz 776878 /blast/blast.cgi 529786 /share/tmp/ 515414 /bioinfo/resources/manuals/ASReml/UserGuide.pdf 403471 /lush/images/newest_pedigree.pdf 206837 /anexdb/downloads/ipa_v1.fa 202411 /lunney/search_results.php 146042 /QTLdb/references/20145704.pdf 134552 /edu/genetics/meiosis.gif 126878 /repository/aquaculture/RTcontig_wv.fa.gz 95390 /tmp/snplot_escalese_DMIa_495O.php 95390 /tmp/snplot_waideeh_DMIa_738G.php 95126 /lunney/genotype.files/Lunney_Original_24_FinalReport_New.txt 93976 /lush/images/PAB_draft_2.pdf 81565 /icons/stat_a.jpg 80287 /anexdb/downloads/Affy_Porcine_Annotation-NX_v1.xls 79538 /edu/QTL/Julius_notes/15_basics_mas.PDF 77882 /QTLdb/references/pub2010WCGALP.pdf 72257 /blast/blast.cgi?INPUT_TYPE=Sequence+in+FASTA+format&SEQUENCE=CTCTTGCCTAATATTCTCCATCTTATTATTGATCATGGTTGTTGTTTCAAGTTGAAACAGCGCTCTAGTACTGCTGTCTTCGAGCATTTTGTTTCTGGAAAAATGACTTTCCAAATTCATATGTACTGATCATAATAGCACAAGCAGGAGCAATTTTAATTAAGCGAGGAATTAGGCCTGTAAATAATCCAGAAAACCCATCCTTAGCAACAATGTTCTTCATTATAGCCCAAGTTGACATTTGCCAAGGCATAGAAACTAAATGTTAAAATAAAGAGATGATACTATTATAAATTACCGCTTAATTTCTAATACAGATAATACACATAGAAGAGTGTTTATGGGAGTTCCCTGGTGGCTCAGTGAGTTAAAGATCTGGCATTGTCACTCCTGTGGCTCTGATTACTGCTGTGGAGCAAGTTCCAACCCTGGCCAGGGA%0D%0A%0D%0A%0D%0A%0D%0A%0D%0A&SEQFILE=&PROGRAM=blastn&DATALIB=Sscrofa10_all.fa&submit.x=48&submit.y=8&submit=Search&FILTER=L&EXPECT=10&MAT_PARAM=BLOSUM62%09+11%09+1&GENETIC_CODE=Standard+%281%29&DB_GENETIC_CODE=Standard+%281%29&OOF_ALIGN=0&OTHER_ADVANCED=&OVERVIEW=on&ALIGNMENT_VIEW=0&DESCRIPTIONS=100&ALIGNMENTS=50&COLOR_SCHEMA=0 70758 /blast/blast.cgi?INPUT_TYPE=Sequence+in+FASTA+format&SEQUENCE=AATCTTCCTTTCCAAACATGTCACTCGGTATTTTTTTTCAAATATATGCCTCAGCCCCATGGGCCATGTCATCATCCATAGTCTTCTCTCTGTTCAGAATGTCCCATTCTCTCCATGTTCAAATCCTTCAAGAGTCAATTTATTTTATTTTATTTTATTTTATTTTGCTTTTCAGGGCTGCACCCGCGGCATGTGGTGGTTCCCAGGCTACAGC%0D%0A%0D%0A%0D%0A%0D%0A%0D%0A&SEQFILE=&PROGRAM=blastn&DATALIB=Sscrofa10_all.fa&submit.x=48&submit.y=8&submit=Search&FILTER=L&EXPECT=10&MAT_PARAM=BLOSUM62%09+11%09+1&GENETIC_CODE=Standard+%281%29&DB_GENETIC_CODE=Standard+%281%29&OOF_ALIGN=0&OTHER_ADVANCED=&OVERVIEW=on&ALIGNMENT_VIEW=0&DESCRIPTIONS=100&ALIGNMENTS=50&COLOR_SCHEMA=0 64373 /tmp/snplot_ercfrtz_Ether_C96.mr_511K.php 62006 /edu/PIH/pigfaq.html 61779 /cgi-bin/gbrowse/cattle/ 58139 / 57599 /aquaculture/salmonids/RainbowProposal.pdf [End of Report] -- Perl program (v.0.369 Jun 26, 2004) by Zhiliang Hu Yagui Wei is acknowledged for sharing his shell script analyzing ftp logs during early stages of this program development.